mRNA technology gene-based mRNA vaccine by Pfizer, Moderna, BioNTech, by Malone, Bourla, Bancel, Sahin, Weissman, deepstate, pharma et al.; is DEADLY, ineffective & these players DECIDED for you that
mRNA technology gene-based mRNA vaccine by Pfizer, Moderna, BioNTech, by Malone, Bourla, Bancel, Sahin, Weissman, deepstate, pharma et al.; is DEADLY, ineffective & these players DECIDED for you that
mRNA technology will underpin your life & they are remaking your life & medicine & healthcare where only therapeutic will be a mRNA vaccine (CRISPR, Cas9, siRNA etc.); all above DECEIVED you! killers
reality is that the mRNA technology they brought us, the mRNA vaccine is pure hell...deadly...no matter how they come back around with it, dont touch it.
This is very technical, so the easy conclusion comes first.
Each human is an animal bio-computer BUT with an immortal soul. Instead of bits (zeros and ones), animals are wet programs based on four letters (A, G, C, T).
I really recommend this article to fully grasp the bio-computer/soul analogy:
Biochemists and micro-biologists have become rookie bio-programmers using parts (sequences) from different viruses, like a computer programmer reuses instructions, algorithms, binary files and libraries, coded by prior programmers.
Unlike computers, which we build from scratch and have the detailed blueprints and know how they should work, lifeforms didn’t come with the Creator’s production specs and manual: we have the job to figure them out, reverse-engineering one word at a time.
The problem is that they are still clueless about many essential processes of the bio-computer, a bio-machine organized like a clock, so amazingly intertwined that, after 8 years of full-time med-school, a physician barely understands it.
Yet, there’s a big difference. If a programmer makes a mistake, he corrects it, and reiterates the process (re-run, reboot): no harm done.
The bio-programmers can’t even correct a botched gene-therapy: genes are altered forever. If a bio-programmer makes a mistake, it could lead to a fatal error, not a blue frozen screen, not a bricked rooted phone, but human deaths. You can’t re-start a bricked human!
Even worse: if the coding mistake gets in the seminal cells, they are passed onto future generations, not just that family tree, but eventually the whole human gene pool, since there’s no natural selection in humans (or a just a mild one).
Some scientists are pride monsters believing they are gods. How in their twisted minds could they think that playing with a known carcinogenic simian virus could end up well?
Even if they’d consider us like cattle (“hackable animals”), there’s no prudence in hacking humans with SV40 sequences they don’t fully understand. A rancher takes care of cattle better than governments of humans. At least the former needs them healthy for a profit, while the latter just wants depopulation.
Nobody seems to be standing in their way, even if they deliberately make bio-weapons (bio-malware)!
SV40 in COVID haccines
Health Canada has written: “It was possible for Health Canada to confirm the presence of the enhancer based on the plasmid DNA sequence submitted by Pfizer against the published SV40 enhancer sequence.”
Like other polyomaviruses, SV40 is a DNA virus that has the potential to cause tumors by suppression of the transcriptional properties of tumor suppressor p53 in humans by the SV40 large T antigen and SV40 small T-antigen. Tumor suppressor p53 is responsible for initiating regulated cell death (apoptosis), or cell cycle arrest when a cell is damaged. A mutated p53 gene may contribute to uncontrolled cellular proliferation, leading to a tumor.” 1
The following explanation helps understand why it was added in Pfizer COVID haccines, causing turbo-cancer: “SV40 T-antigen uses a DNA shearing mechanism to initiate origin unwinding” 2 “The mechanisms of SV40 tumorigenesis in humans are related to the properties of the two viral oncoproteins, the large T antigen (Tag) and the small t antigen (tag). Tag acts mainly by blocking the functions of p53 and RB tumor suppressor proteins, as well as by inducing chromosomal aberrations in the host cell. These chromosome alterations may hit genes important in oncogenesis and generate genetic instability in tumor cells.” 3:
a) “SV40 large T antigen targets multiple cellular pathways to elicit cellular transformation” 4
b) “A fail-safe system to prevent oncogenesis by senescence is targeted by SV40 small T antigen” 5
New England Journal of Medicine study confirmed that viral promoter with SV40 sequence caused cancer: gene-therapy Skysona (eli-cel), caused blood cancer (e.g. leukemia) in 10% of patients 6, possibly more, since “more patients may appear over time” 7.
The drug had been 2022 FDA fast-track approved with a black box warning for the cancer “side effect”: in 2021 the FDA had put a clinical hold on eli-cel trials after the company, Bluebird Bio, found that the treatment caused a cancer-like condition in one patient, while two other patients were also being monitored for similar symptoms.8
“Stem cells are isolated and modified by using a lentiviral vector to add the ABCD1 gene9. The stem cells in bone marrow are killed with chemotherapy, and replaced with the modified stem cells.
Cause of cancer: Multiple off-target insertions, different ones for different people. Eli-cel causes cancer because it is:
- specifically done to stem cells, which are closer to cancer than usual
- applied to cells away from the immune system, which can often detect infections and kill infected cells early.” 10
The cases of cancer may have been driven by the design of the lentiviral vector used in Skysona: “using a lentivirus to insert a functioning form of the ABCD1 gene”: “a risk of that type of promoter (MNDU3) is oncogenesis, or driving the development of cancer, Duncan [lead author] explained” 11 The promoter plasmid12 has:
• SV40 ori: “The SV40 origin of replication comprises a run of thymine and adenine residues. Integrity of this AT-rich sequence is known to be essential for replication.” 13 “... interactions of simian virus 40 (SV40) large tumor antigen (large T) with the control region of the SV40 genome” 14 … “The simian virus 40 T tumor antigen (SVLT) induces replication of plasmids bearing the SV40 origin of replication (SV40 ori) within mammalian cells.” 15
• EBV Reverse, GTGGTTTGTCCAAACTCATC (Invitrogen), SV40 polyA terminator, reverse primer
• SV40 poly(A) signal, for “improved transcript life”16 “eliminated the inhibition induced by Alu14”17
• SV40pA-R, GAAATTTGTGATGCTATTGC, reverse primer SV40 polyA a “tool for accurate control of the relative expression levels of multiple genes. It has wide-ranging applications in fields related to the study of biosynthesis of multi-subunit proteins, proteomic research on protein interactions, and multi-gene metabolic engineering” 18 and directed evolution19.
• HIV-1 Ψ (psi) 20 for translation inhibition of HIV-1 full length mRNA.21
SV40 sequencing primers not used or not disclosed22:
SV40pro-F, TATTTATGCAGAGGCCGAGG, SV40 promoter/origin, forward primer
SV40-spliceR, CACAAAGATCCGGACCAAAG, SV40 splice sequence, reverse primer
pBABE 3', ACCCTAACTGACACACATTCC (Weinberg Lab), SV40 enhancer, 3' of MCS in pBABE vectors, reverse primer
Plasmid-Gate
2023. Dr. Speicher's testing revealed DNA levels between 7 to 145 times higher than the 10ng per dose Australian FDA (Therapeutic Goods Administration TGA) limit.23 TGA rejected this by only looking at naked DNA, not the all the DNA encapsulated in the lipid nano-particles24, only targeting fragments over 200 base pairs (lowest risk)25, failing to detect the bulk of the contamination, by using qPCR which under-measures synthetic DNA26 and not disclosing their test methods.
Still, the 10 ng limit was copied from the FDA, which was not based on science but on a meeting of “experts” based on “opinions”, and was applicable only to residual DNA, not DNA-plasmid bio-weapons:
2024. Dr. Konig also proved DNA plasmid “contamination”.27
Pfizer’s mRNA injections are for gene-editing. “In collaboration with biotech company Beam Therapeutics, Pfizer scientists are developing mRNA technology as a new approach to gene editing … lipid nanoparticles ... have the potential to add, remove, ... faulty genes”. 28
3 Jan 2024. Florida Surgeon Genral warned of cancer and other side effects:
“discovery of billions of DNA fragments per dose of the Pfizer and Moderna COVID-19 mRNA vaccines … concerns regarding nucleic acid contaminants in the approved Pfizer and Moderna COVID-19 mRNA vaccines, particularly in the presence of lipid nanoparticle complexes, and Simian Virus 40 (SV40) promoter/enhancer DNA. Lipid nanoparticles are an efficient vehicle for delivery of the mRNA in the COVID-19 vaccines into human cells and may therefore be an equally efficient vehicle for delivering contaminant DNA into human cells. The presence of SV40 promoter/enhancer DNA may also pose a unique and heightened risk of DNA integration into human cells.” 29
12 Sep 2024. “Florida Surgeon General Calls for Halt of Covid-19 Vaccine for Safety Reasons”:
“Potential DNA integration30 from the mRNA COVID-19 vaccines pose unique and elevated risk to human health and to the integrity of the human genome, including the risk that DNA integrated into sperm or egg gametes could be passed onto offspring of mRNA COVID-19 vaccine recipients.” 31
3 Jan 2024. Florida Surgeon General: Pfizer’s and the FDA’s lack of proper animal and human testing (bona fide research) is beyond reckless as the mRNA nanoparticle technologies have the capability of introducing oncogenes (genes that cause cancer) as well as making transgenerational changes to the human species. 32
8 May 2024. First published peer reviewed study found synthetic DNA wrapped in LNPs:
“very high DNA values were measurable in all batches after Triton-X-100 treatment, with these values ranging from 360 to 534 times the permissible DNA limit or 3600 to 5340 ng DNA per dose.
“… to dissolve the lipid nanoparticles with a detergent to directly measure DNA contamination in the final product by using fluorescence spectroscopic methods” 33 a $10 test would have been enough to detect the DNA presence!
Wow and wow what an interesting I series read here. Im speachless after video with Mario Joseph. I will have to show it to my wife a devout catholic. Message' Bring back the Love' resonates with me. Thank You.
Yes, Dr. P. We must make mRNA LNP technology a movement to ban it entirely. We have to keep on showing the harms, & discussing the harmful ingredients, the harmful effects, the deaths & injuries galore! We can’t let this technology expand into all medicines. Nor foods, or anything else. It’s bad stuff. Very bad. And scary. With how they want to mandate vaccines via your digital id & carbon footprint. This whole plan is diabolical & plain evil. The love of money must never rise above God & his perfect creation of humans and animals & all the rest. They have to walk this crazy shit back! My God! When will we stop these psychopaths from ruining our lives? They keep pushing more & more vaccines on babies. Getting all their poison shots on the childhood schedule to have full immunity from liability. It’s insane! And sad. Really is.
This is disgusting, Paul. Bad enough what we have seen/endured for the past several years - now guys in the White Hats are donning Black Hats ?
For the love of money....
Not a foreign concept, but infuriating as hell.
Those of us reading here will surely keep away from it - for as long as we are able. We all know that one day, if "they" have their way, a digital ID and our social credit score will determine our ability to thrive in the world they envision for us.
We certainly have lots to fight for, don't we ?! F them.
This is shocking and extremely disturbing to hear! I can’t fathom that will be possible. If RFK Jr is on the team w Trump, how will he allow Trump to push these harmful and deadly shots?
45 still touts the shots...no? Trump knows the shots are deadly....as some here have said, its an election decision...we wait. we wait...but we will not let this go...no matter who.
have you noticed Bobby Jr. is silent on the vaccine after being against it? let us see what Bobby Jr. does post election. silence post election will not be good as will signal the got to him. he is a good man, smart and wanted and wants to do good...lets see. but what I wrote above is the plan and it has started.
I certainly wouldn’t believe it if Dr Peter McCullough turned for the $$$. I am 100000% certain Kennedy will never endorse those shots!!! He was screwed by Trump once, and it’s highly probable it will happen again. It’s all a gamble. He took it.
I do have concerns about Dr. McCullough's theory that he can treat the vax injured with "small interfering messenger RNA (siRNA) and ribonuclease targeting chimeras (RIBOTACs) to bind and deactivate the mRNA from these vaccines."
I believe that will compound the danger.
I steadfastly believe that ANY tampering with the building blocks of life is foolhardy and should be categorically prohibited.
I'd like to think so, but it won't be true until everyone who mandated it has been tried and hanged for crimes against humanity. There is nothing other than hangings which will get them to stop pushing that poison.
Research has been reported recently that purports to show that getting boosters of the existing shots may stimulate mucosal immunity, although there are conflicting results. See the story at the link. However the new improved JD VANCE mRNA TECH, once rolled out, is likely to make the old mRNA TECH obsolete.
Excerpt
"Collectively, these results demonstrate that, especially upon repeated vaccination, the currently used COVID-19 mRNA vaccines can elicit mucosal NAbs and that vaccination might also stimulate mucosal immunity induced by previous SARS-CoV-2 infection,” the study authors wrote. “Moreover, migration of circulating antibodies to the respiratory mucosa might be a main mechanism.”
Yes, a Democide by any other name... but you can't sell a product unless you have created a market for that product, or at the very least have a throng of people who want the product. The Satanic way is to get people to be willing participants in their own demise. You have to get them to kill themselves. There are many, many people who only watch MSNBC, CNN, etc. and they haven't a clue that they have been thoroughly indoctrinated and brainwashed. These lost ones will gladly walk in to gas chambers thinking they are saving the planet.
For most of the lost ones it is too late... they have passed the Event Horizon and are just waiting to receive their Darwin Awards...waiting because there has been such a demand of Darwin Awards there is a back order... (Gallos humor).
So, what happens next.... what ever "they" are going to manifest will end their control of humanity. It will be as a surprise to them as the rest of us, but that is how it will end.
with Trump we have a chance...and again, I have said if we get 5% we will get way more than with anyone else and we grab that but we got to stand on 45 to fix USA,...he is the one
reality is that the mRNA technology they brought us, the mRNA vaccine is pure hell...deadly...no matter how they come back around with it, dont touch it.
'Til the day I die, I'll repeat that this was the most evil crime perpetrated on all of humanity in history.
Maybe something will surpass it in the future, but as of today it stands unequaled in scope.
Certain key individuals absolutely **MUST** pay a huge price for their part in this monstrous crime.
Agree. Agree. Agree.
These are LIFE SHORTENING PLATFORMS.
mRNA (and DNA in them) is TOTAL HARM in a SYRINGE.
kaboom as always Dr. Shoemaker
Don't forget SV-40 and DNA plasmids!
I'll publish about that after the elections.
This is very technical, so the easy conclusion comes first.
Each human is an animal bio-computer BUT with an immortal soul. Instead of bits (zeros and ones), animals are wet programs based on four letters (A, G, C, T).
I really recommend this article to fully grasp the bio-computer/soul analogy:
https://www.catholic365.com/article/26130/dog-beats-artificial-intelligence.html
Biochemists and micro-biologists have become rookie bio-programmers using parts (sequences) from different viruses, like a computer programmer reuses instructions, algorithms, binary files and libraries, coded by prior programmers.
Unlike computers, which we build from scratch and have the detailed blueprints and know how they should work, lifeforms didn’t come with the Creator’s production specs and manual: we have the job to figure them out, reverse-engineering one word at a time.
The problem is that they are still clueless about many essential processes of the bio-computer, a bio-machine organized like a clock, so amazingly intertwined that, after 8 years of full-time med-school, a physician barely understands it.
Yet, there’s a big difference. If a programmer makes a mistake, he corrects it, and reiterates the process (re-run, reboot): no harm done.
The bio-programmers can’t even correct a botched gene-therapy: genes are altered forever. If a bio-programmer makes a mistake, it could lead to a fatal error, not a blue frozen screen, not a bricked rooted phone, but human deaths. You can’t re-start a bricked human!
Even worse: if the coding mistake gets in the seminal cells, they are passed onto future generations, not just that family tree, but eventually the whole human gene pool, since there’s no natural selection in humans (or a just a mild one).
Some scientists are pride monsters believing they are gods. How in their twisted minds could they think that playing with a known carcinogenic simian virus could end up well?
Even if they’d consider us like cattle (“hackable animals”), there’s no prudence in hacking humans with SV40 sequences they don’t fully understand. A rancher takes care of cattle better than governments of humans. At least the former needs them healthy for a profit, while the latter just wants depopulation.
Nobody seems to be standing in their way, even if they deliberately make bio-weapons (bio-malware)!
SV40 in COVID haccines
Health Canada has written: “It was possible for Health Canada to confirm the presence of the enhancer based on the plasmid DNA sequence submitted by Pfizer against the published SV40 enhancer sequence.”
Like other polyomaviruses, SV40 is a DNA virus that has the potential to cause tumors by suppression of the transcriptional properties of tumor suppressor p53 in humans by the SV40 large T antigen and SV40 small T-antigen. Tumor suppressor p53 is responsible for initiating regulated cell death (apoptosis), or cell cycle arrest when a cell is damaged. A mutated p53 gene may contribute to uncontrolled cellular proliferation, leading to a tumor.” 1
The following explanation helps understand why it was added in Pfizer COVID haccines, causing turbo-cancer: “SV40 T-antigen uses a DNA shearing mechanism to initiate origin unwinding” 2 “The mechanisms of SV40 tumorigenesis in humans are related to the properties of the two viral oncoproteins, the large T antigen (Tag) and the small t antigen (tag). Tag acts mainly by blocking the functions of p53 and RB tumor suppressor proteins, as well as by inducing chromosomal aberrations in the host cell. These chromosome alterations may hit genes important in oncogenesis and generate genetic instability in tumor cells.” 3:
a) “SV40 large T antigen targets multiple cellular pathways to elicit cellular transformation” 4
b) “A fail-safe system to prevent oncogenesis by senescence is targeted by SV40 small T antigen” 5
New England Journal of Medicine study confirmed that viral promoter with SV40 sequence caused cancer: gene-therapy Skysona (eli-cel), caused blood cancer (e.g. leukemia) in 10% of patients 6, possibly more, since “more patients may appear over time” 7.
The drug had been 2022 FDA fast-track approved with a black box warning for the cancer “side effect”: in 2021 the FDA had put a clinical hold on eli-cel trials after the company, Bluebird Bio, found that the treatment caused a cancer-like condition in one patient, while two other patients were also being monitored for similar symptoms.8
“Stem cells are isolated and modified by using a lentiviral vector to add the ABCD1 gene9. The stem cells in bone marrow are killed with chemotherapy, and replaced with the modified stem cells.
Cause of cancer: Multiple off-target insertions, different ones for different people. Eli-cel causes cancer because it is:
- specifically done to stem cells, which are closer to cancer than usual
- applied to cells away from the immune system, which can often detect infections and kill infected cells early.” 10
The cases of cancer may have been driven by the design of the lentiviral vector used in Skysona: “using a lentivirus to insert a functioning form of the ABCD1 gene”: “a risk of that type of promoter (MNDU3) is oncogenesis, or driving the development of cancer, Duncan [lead author] explained” 11 The promoter plasmid12 has:
• SV40 ori: “The SV40 origin of replication comprises a run of thymine and adenine residues. Integrity of this AT-rich sequence is known to be essential for replication.” 13 “... interactions of simian virus 40 (SV40) large tumor antigen (large T) with the control region of the SV40 genome” 14 … “The simian virus 40 T tumor antigen (SVLT) induces replication of plasmids bearing the SV40 origin of replication (SV40 ori) within mammalian cells.” 15
• EBV Reverse, GTGGTTTGTCCAAACTCATC (Invitrogen), SV40 polyA terminator, reverse primer
• SV40 poly(A) signal, for “improved transcript life”16 “eliminated the inhibition induced by Alu14”17
• SV40pA-R, GAAATTTGTGATGCTATTGC, reverse primer SV40 polyA a “tool for accurate control of the relative expression levels of multiple genes. It has wide-ranging applications in fields related to the study of biosynthesis of multi-subunit proteins, proteomic research on protein interactions, and multi-gene metabolic engineering” 18 and directed evolution19.
• HIV-1 Ψ (psi) 20 for translation inhibition of HIV-1 full length mRNA.21
https://www.addgene.org/81071/
SV40 sequencing primers not used or not disclosed22:
SV40pro-F, TATTTATGCAGAGGCCGAGG, SV40 promoter/origin, forward primer
SV40-spliceR, CACAAAGATCCGGACCAAAG, SV40 splice sequence, reverse primer
pBABE 3', ACCCTAACTGACACACATTCC (Weinberg Lab), SV40 enhancer, 3' of MCS in pBABE vectors, reverse primer
Plasmid-Gate
2023. Dr. Speicher's testing revealed DNA levels between 7 to 145 times higher than the 10ng per dose Australian FDA (Therapeutic Goods Administration TGA) limit.23 TGA rejected this by only looking at naked DNA, not the all the DNA encapsulated in the lipid nano-particles24, only targeting fragments over 200 base pairs (lowest risk)25, failing to detect the bulk of the contamination, by using qPCR which under-measures synthetic DNA26 and not disclosing their test methods.
Still, the 10 ng limit was copied from the FDA, which was not based on science but on a meeting of “experts” based on “opinions”, and was applicable only to residual DNA, not DNA-plasmid bio-weapons:
2024. Dr. Konig also proved DNA plasmid “contamination”.27
Pfizer’s mRNA injections are for gene-editing. “In collaboration with biotech company Beam Therapeutics, Pfizer scientists are developing mRNA technology as a new approach to gene editing … lipid nanoparticles ... have the potential to add, remove, ... faulty genes”. 28
https://www.pfizer.com/news/behind-the-science/unlocking-power-our-bodys-protein-factory
3 Jan 2024. Florida Surgeon Genral warned of cancer and other side effects:
“discovery of billions of DNA fragments per dose of the Pfizer and Moderna COVID-19 mRNA vaccines … concerns regarding nucleic acid contaminants in the approved Pfizer and Moderna COVID-19 mRNA vaccines, particularly in the presence of lipid nanoparticle complexes, and Simian Virus 40 (SV40) promoter/enhancer DNA. Lipid nanoparticles are an efficient vehicle for delivery of the mRNA in the COVID-19 vaccines into human cells and may therefore be an equally efficient vehicle for delivering contaminant DNA into human cells. The presence of SV40 promoter/enhancer DNA may also pose a unique and heightened risk of DNA integration into human cells.” 29
12 Sep 2024. “Florida Surgeon General Calls for Halt of Covid-19 Vaccine for Safety Reasons”:
“Potential DNA integration30 from the mRNA COVID-19 vaccines pose unique and elevated risk to human health and to the integrity of the human genome, including the risk that DNA integrated into sperm or egg gametes could be passed onto offspring of mRNA COVID-19 vaccine recipients.” 31
3 Jan 2024. Florida Surgeon General: Pfizer’s and the FDA’s lack of proper animal and human testing (bona fide research) is beyond reckless as the mRNA nanoparticle technologies have the capability of introducing oncogenes (genes that cause cancer) as well as making transgenerational changes to the human species. 32
8 May 2024. First published peer reviewed study found synthetic DNA wrapped in LNPs:
“very high DNA values were measurable in all batches after Triton-X-100 treatment, with these values ranging from 360 to 534 times the permissible DNA limit or 3600 to 5340 ng DNA per dose.
“… to dissolve the lipid nanoparticles with a detergent to directly measure DNA contamination in the final product by using fluorescence spectroscopic methods” 33 a $10 test would have been enough to detect the DNA presence!
Wow and wow what an interesting I series read here. Im speachless after video with Mario Joseph. I will have to show it to my wife a devout catholic. Message' Bring back the Love' resonates with me. Thank You.
Yes, Dr. P. We must make mRNA LNP technology a movement to ban it entirely. We have to keep on showing the harms, & discussing the harmful ingredients, the harmful effects, the deaths & injuries galore! We can’t let this technology expand into all medicines. Nor foods, or anything else. It’s bad stuff. Very bad. And scary. With how they want to mandate vaccines via your digital id & carbon footprint. This whole plan is diabolical & plain evil. The love of money must never rise above God & his perfect creation of humans and animals & all the rest. They have to walk this crazy shit back! My God! When will we stop these psychopaths from ruining our lives? They keep pushing more & more vaccines on babies. Getting all their poison shots on the childhood schedule to have full immunity from liability. It’s insane! And sad. Really is.
This is disgusting, Paul. Bad enough what we have seen/endured for the past several years - now guys in the White Hats are donning Black Hats ?
For the love of money....
Not a foreign concept, but infuriating as hell.
Those of us reading here will surely keep away from it - for as long as we are able. We all know that one day, if "they" have their way, a digital ID and our social credit score will determine our ability to thrive in the world they envision for us.
We certainly have lots to fight for, don't we ?! F them.
Never comply.
This is shocking and extremely disturbing to hear! I can’t fathom that will be possible. If RFK Jr is on the team w Trump, how will he allow Trump to push these harmful and deadly shots?
45 still touts the shots...no? Trump knows the shots are deadly....as some here have said, its an election decision...we wait. we wait...but we will not let this go...no matter who.
accountability must be had for the people.
have you noticed Bobby Jr. is silent on the vaccine after being against it? let us see what Bobby Jr. does post election. silence post election will not be good as will signal the got to him. he is a good man, smart and wanted and wants to do good...lets see. but what I wrote above is the plan and it has started.
question is WHO will turn?
how fast? for how much?
I certainly wouldn’t believe it if Dr Peter McCullough turned for the $$$. I am 100000% certain Kennedy will never endorse those shots!!! He was screwed by Trump once, and it’s highly probable it will happen again. It’s all a gamble. He took it.
I do have concerns about Dr. McCullough's theory that he can treat the vax injured with "small interfering messenger RNA (siRNA) and ribonuclease targeting chimeras (RIBOTACs) to bind and deactivate the mRNA from these vaccines."
I believe that will compound the danger.
I steadfastly believe that ANY tampering with the building blocks of life is foolhardy and should be categorically prohibited.
I took the gamble too and voted Trump. It wouldn’t surprise me if Trump endorses the deadly shots….but I will be angry!
"mRNA is over, it is DEAD"
I'd like to think so, but it won't be true until everyone who mandated it has been tried and hanged for crimes against humanity. There is nothing other than hangings which will get them to stop pushing that poison.
Hi Dr. Alexander, Could you please list the names. Thank you very much.
Creating " Vaxaddicts" requiring an injection to remain alive, as a Drug addiction will do?.
yes Sir...exactly that...on a booster treadmill. they seek to replace all drugs etc. with mRNA vaccine
Guaranteed customers, a cured Patient, is a lost Customer, and $$...
Research has been reported recently that purports to show that getting boosters of the existing shots may stimulate mucosal immunity, although there are conflicting results. See the story at the link. However the new improved JD VANCE mRNA TECH, once rolled out, is likely to make the old mRNA TECH obsolete.
Excerpt
"Collectively, these results demonstrate that, especially upon repeated vaccination, the currently used COVID-19 mRNA vaccines can elicit mucosal NAbs and that vaccination might also stimulate mucosal immunity induced by previous SARS-CoV-2 infection,” the study authors wrote. “Moreover, migration of circulating antibodies to the respiratory mucosa might be a main mechanism.”
https://www.cidrap.umn.edu/covid-19/can-covid-vaccines-induce-mucosal-immunity-two-studies-offer-conflicting-findings
However the new improved JD VANCE mRNA TECH, once rolled out, is likely to make the old mRNA TECH obsolete.
not on my watch ANW...
JD and folk like me will have lots to chat about.
I dont buy the conclusions...
Nor do I.
Yes, a Democide by any other name... but you can't sell a product unless you have created a market for that product, or at the very least have a throng of people who want the product. The Satanic way is to get people to be willing participants in their own demise. You have to get them to kill themselves. There are many, many people who only watch MSNBC, CNN, etc. and they haven't a clue that they have been thoroughly indoctrinated and brainwashed. These lost ones will gladly walk in to gas chambers thinking they are saving the planet.
For most of the lost ones it is too late... they have passed the Event Horizon and are just waiting to receive their Darwin Awards...waiting because there has been such a demand of Darwin Awards there is a back order... (Gallos humor).
So, what happens next.... what ever "they" are going to manifest will end their control of humanity. It will be as a surprise to them as the rest of us, but that is how it will end.
this election is critical to answer your question
with Trump we have a chance...and again, I have said if we get 5% we will get way more than with anyone else and we grab that but we got to stand on 45 to fix USA,...he is the one
many forces against him
The Wellness Company, $10,000.00/mo per executive and direct takedown of Amazing Pauly pointing out the Fraud